Class: Bio::Blast

Object show all
Defined in:



The Bio::Blast class contains methods for running local or remote BLAST searches, as well as for parsing of the output of such BLASTs (i.e. the BLAST reports). For more information on similarity searches and the BLAST program, see


require 'bio'

# To run an actual BLAST analysis:
#   1. create a BLAST factory
remote_blast_factory = Bio::Blast.remote('blastp', 'swissprot',
                                         '-e 0.0001', 'genomenet')#or:

local_blast_factory = Bio::Blast.local('blastn','/path/to/db')

#   2. run the actual BLAST by querying the factory
report = remote_blast_factory.query(sequence_text)

# Then, to parse the report, see Bio::Blast::Report

See also

  • Bio::Blast::Report

  • Bio::Blast::Report::Hit

  • Bio::Blast::Report::Hsp


Defined Under Namespace

Modules: Default, RPSBlast, Remote, WU Classes: Bl2seq, Fastacmd, NCBIOptions, Report, Report_tab

Instance Attribute Summary collapse

Class Method Summary collapse

Instance Method Summary collapse

Constructor Details

#initialize(program, db, opt = [], server = 'local') ⇒ Blast

Creates a Bio::Blast factory object.

To run any BLAST searches, a factory has to be created that describes a certain BLAST pipeline: the program to use, the database to search, any options and the server to use. E.g.

blast_factory ='blastn','dbsts', '-e 0.0001 -r 4', 'genomenet')


  • program (required): 'blastn', 'blastp', 'blastx', 'tblastn' or 'tblastx'

  • db (required): name of the (local or remote) database

  • options: blastall options \


  • server: server to use (e.g. 'genomenet'; DEFAULT = 'local')


Bio::Blast factory object

# File 'lib/bio/appl/blast.rb', line 317

def initialize(program, db, opt = [], server = 'local')
  @program  = program
  @db       = db

  @blastall = 'blastall'
  @matrix   = nil
  @filter   = nil

  @output   = ''
  @parser   = nil
  @format   = nil

  @options = set_options(opt, program, db)
  self.server = server

Instance Attribute Details


Full path for blastall. (default: 'blastall').

# File 'lib/bio/appl/blast.rb', line 280

def blastall


Database name (-d option for blastall)

# File 'lib/bio/appl/blast.rb', line 249

def db


Filter option for blastall -F (T or F).

# File 'lib/bio/appl/blast.rb', line 286

def filter


Output report format for blastall -m

0, pairwise; 1; 2; 3; 4; 5; 6; 7, XML Blast outpu;, 8, tabular; 9, tabular with comment lines; 10, ASN text; 11, ASN binery [intege].

# File 'lib/bio/appl/blast.rb', line 295

def format


Substitution matrix for blastall -M

# File 'lib/bio/appl/blast.rb', line 283

def matrix


Options for blastall

# File 'lib/bio/appl/blast.rb', line 252

def options

#outputObject (readonly)

Returns a String containing blast execution output in as is the Bio::Blast#format.

# File 'lib/bio/appl/blast.rb', line 289

def output

#parser=(value) ⇒ Object (writeonly)

to change :xmlparser, :rexml, :tab

# File 'lib/bio/appl/blast.rb', line 298

def parser=(value)
  @parser = value


Program name (-p option for blastall): blastp, blastn, blastx, tblastn or tblastx

# File 'lib/bio/appl/blast.rb', line 246

def program


Server to submit the BLASTs to

# File 'lib/bio/appl/blast.rb', line 260

def server

Class Method Details

.local(program, db, options = '', blastall = nil) ⇒ Object

This is a shortcut for

Bio::Blast.local(program, database, options)

is equivalent to, database, options, 'local')


  • program (required): 'blastn', 'blastp', 'blastx', 'tblastn' or 'tblastx'

  • db (required): name of the local database

  • options: blastall options \


  • blastall: full path to blastall program (e.g. “/opt/bin/blastall”; DEFAULT: “blastall”)


Bio::Blast factory object

# File 'lib/bio/appl/blast.rb', line 79

def self.local(program, db, options = '', blastall = nil)
  f =, db, options, 'local')
  if blastall then
    f.blastall = blastall

.remote(program, db, option = '', server = 'genomenet') ⇒ Object

Bio::Blast.remote does exactly the same as, but sets the remote server 'genomenet' as its default.


  • program (required): 'blastn', 'blastp', 'blastx', 'tblastn' or 'tblastx'

  • db (required): name of the remote database

  • options: blastall options \


  • server: server to use (DEFAULT = 'genomenet')


Bio::Blast factory object

# File 'lib/bio/appl/blast.rb', line 97

def self.remote(program, db, option = '', server = 'genomenet'), db, option, server)

.reports(input, parser = nil) ⇒ Object parses given data, and returns an array of report (Bio::Blast::Report or Bio::Blast::Default::Report) objects, or yields each report object when a block is given.

Supported formats: NCBI default (-m 0), XML (-m 7), tabular (-m 8).


  • input (required): input data

  • parser: type of parser. see


Undefiend when a block is given. Otherwise, an Array containing report (Bio::Blast::Report or Bio::Blast::Default::Report) objects.

# File 'lib/bio/appl/blast.rb', line 114

def self.reports(input, parser = nil)
    istr = input.to_str
  rescue NoMethodError
    istr = nil
  if istr then
    input =
  raise 'unsupported input data type' unless input.respond_to?(:gets)

  # if proper parser is given, emulates old behavior.
  case parser
  when :xmlparser, :rexml
    ff =, input)
    if block_given? then
      ff.each do |e|
        yield e
      return []
      return ff.to_a
  when :tab
    istr = unless istr
    rep =, parser)
    if block_given? then
      yield rep
      return []
      return [ rep ]

  # preparation of the new format autodetection rule if needed
  if !defined?(@@reports_format_autodetection_rule) or
      !@@reports_format_autodetection_rule then
    regrule = Bio::FlatFile::AutoDetect::RuleRegexp
    blastxml = regrule[ 'Bio::Blast::Report',
                        /\<\!DOCTYPE BlastOutput PUBLIC / ]
    blast    = regrule[ 'Bio::Blast::Default::Report',
                        /^BLAST.? +[\-\.\w]+ +\[[\-\.\w ]+\]/ ]
    tblast   = regrule[ 'Bio::Blast::Default::Report_TBlast',
                        /^TBLAST.? +[\-\.\w]+ +\[[\-\.\w ]+\]/ ]
    tab      = regrule[ 'Bio::Blast::Report_tab',
                        /^([^\t]*\t){11}[^\t]*$/ ]
    auto = Bio::FlatFile::AutoDetect[ blastxml,
                                    ]    # sets priorities

    blastxml.is_prior_to blast
    blast.is_prior_to tblast
    tblast.is_prior_to tab    # rehash

    @@report_format_autodetection_rule = auto

  # Creates a FlatFile object with dummy class
  ff =, input)
  ff.dbclass = nil

  # file format autodetection
  3.times do
    break if ff.eof? or
      ff.autodetect(31, @@report_format_autodetection_rule)
  end  # If format detection failed, assumed to be tabular (-m 8)

  ff.dbclass = Bio::Blast::Report_tab unless ff.dbclass

  if block_given? then
    ff.each do |entry|
      yield entry
    ret = []
    ret = ff.to_a

.reports_xml(input, parser = nil) ⇒ Object

Note that this is the old implementation of Bio::Blast.reports. The aim of this method is keeping compatibility for older BLAST XML documents which might not be parsed by the new Bio::Blast.reports nor Bio::FlatFile. (Though we are not sure whether such documents exist or not.)

Bio::Blast.reports_xml parses given data, and returns an array of Bio::Blast::Report objects, or yields each Bio::Blast::Report object when a block is given.

It can be used only for XML format. For default (-m 0) format, consider using Bio::FlatFile, or Bio::Blast.reports.


  • input (required): input data

  • parser: type of parser. see


Undefiend when a block is given. Otherwise, an Array containing Bio::Blast::Report objects.

# File 'lib/bio/appl/blast.rb', line 220

def self.reports_xml(input, parser = nil)
  ary = []
  input.each_line("</BlastOutput>\n") do |xml|
    xml.sub!(/[^<]*(<?)/, '\1') # skip before <?xml> tag
    next if xml.empty?          # skip trailing no hits
    rep =, parser)
    if rep.reports then
      if block_given?
        rep.reports.each { |r| yield r }
        ary.concat rep.reports
      if block_given?
        yield rep
        ary.push rep
  return ary

Instance Method Details


Returns options of blastall

# File 'lib/bio/appl/blast.rb', line 374

def option  # backward compatibility


#option=(str) ⇒ Object

Set options for blastall

# File 'lib/bio/appl/blast.rb', line 380

def option=(str)
  # backward compatibility
  self.options = Shellwords.shellwords(str)

#query(query) ⇒ Object

This method submits a sequence to a BLAST factory, which performs the actual BLAST.

# example 1
seq ='agggcattgccccggaagatcaagtcgtgctcctg')
report = blast_factory.query(seq)

# example 2
report = blast_factory.query(str)

Bug note: When multi-FASTA is given and the format is 7 (XML) or 8 (tab), it should return an array of Bio::Blast::Report objects, but it returns a single Bio::Blast::Report object. This is a known bug and should be fixed in the future.


  • query (required): single- or multiple-FASTA formatted sequence(s)


a Bio::Blast::Report (or Bio::Blast::Default::Report) object when single query is given. When multiple sequences are given as the query, it returns an array of Bio::Blast::Report (or Bio::Blast::Default::Report) objects. If it can not parse result, nil will be returnd.

# File 'lib/bio/appl/blast.rb', line 358

def query(query)
  case query
  when Bio::Sequence
    query = query.output(:fasta)
  when Bio::Sequence::NA, Bio::Sequence::AA, Bio::Sequence::Generic
    query = query.to_fasta('query', 70)
    query = query.to_s

  @output = self.__send__("exec_#{@server}", query)
  report = parse_result(@output)
  return report