Class: Bio::SOFT

  • Object
show all
Defined in:


bio/db/soft.rb - Interface for SOFT formatted files


Trevor Wennblom <[email protected]>


Copyright © 2007 Midwinter Laboratories, LLC (


The Ruby License


“SOFT (Simple Omnibus in Text Format) is a compact, simple, line-based, ASCII text format that incorporates experimental data and metadata.” – GEO, National Center for Biotechnology Information

The Bio::SOFT module reads SOFT Series or Platform formatted files that contain information describing one database, one series, one platform, and many samples (GEO accessions). The data from the file can then be viewed with Ruby methods.

Bio::SOFT also supports the reading of SOFT DataSet files which contain one database, one dataset, and many subsets.

Format specification is located here:

SOFT data files may be directly downloaded here:

NCBI's Gene Expression Omnibus (GEO) is here:


If an attribute has more than one value then the values are stored in an Array of String objects. Otherwise the attribute is stored as a String.

The platform and each sample may contain a table of data. A dataset from a DataSet file may also contain a table.

Attributes are dynamically created based on the data in the file. Predefined keys have not been created in advance due to the variability of SOFT files in-the-wild.

Keys are generally stored as Symbols. In the case of keys for samples and table headings may alternatively be accessed with Strings. The names of samples (geo accessions) are case sensitive. Table headers are case insensitive.

require 'bio'

lines = IO.readlines('GSE3457_family.soft') 
soft =

soft.platform[:geo_accession]             # => "GPL2092"
soft.platform[:organism]                  # => "Populus"
soft.platform[:contributor]               # => ["Jingyi,,Li", "Olga,,Shevchenko", "Steve,H,Strauss", "Amy,M,Brunner"]
soft.platform[:data_row_count]            # => "240"
soft.platform.keys.sort {|a,b| a.to_s <=> b.to_s}[0..2] # => [:contact_address, :contact_city, :contact_country]
soft.platform[:"contact_zip/postal_code"] # => "97331"
soft.platform[:table].header              # => ["ID", "GB_ACC", "SPOT_ID", "Function/Family", "ORGANISM", "SEQUENCE"]
soft.platform[:table].header_description  # => {"ORGANISM"=>"sequence sources", "SEQUENCE"=>"oligo sequence used", "Function/Family"=>"gene functions and family", "ID"=>"", "SPOT_ID"=>"", "GB_ACC"=>"Gene bank accession number"}
soft.platform[:table].rows.size           # => 240
soft.platform[:table].rows[5]             # => ["A039P68U", "AI163321", "", "TF, flowering protein CONSTANS", "P. tremula x P. tremuloides", "AGAAAATTCGATATACTGTCCGTAAAGAGGTAGCACTTAGAATGCAACGGAATAAAGGGCAGTTCACCTC"]
soft.platform[:table].rows[5][4]          # => "P. tremula x P. tremuloides"
soft.platform[:table].rows[5][:organism]  # => "P. tremula x P. tremuloides"
soft.platform[:table].rows[5]['ORGANISM'] # => "P. tremula x P. tremuloides"

soft.series[:geo_accession]               # => "GSE3457"
soft.series[:contributor]                 # => ["Jingyi,,Li", "Olga,,Shevchenko", "Ove,,Nilsson", "Steve,H,Strauss", "Amy,M,Brunner"]
soft.series[:platform_id]                 # => "GPL2092"
soft.series[:sample_id].size              # => 74
soft.series[:sample_id][0..4]             # => ["GSM77557", "GSM77558", "GSM77559", "GSM77560", "GSM77561"]

soft.database[:name]                      # => "Gene Expression Omnibus (GEO)"
soft.database[:ref]                       # => "Nucleic Acids Res. 2005 Jan 1;33 Database Issue:D562-6"
soft.database[:institute]                 # => "NCBI NLM NIH"

soft.samples.size                         # => 74
soft.samples[:GSM77600][:series_id]       # => "GSE3457"
soft.samples['GSM77600'][:series_id]      # => "GSE3457"
soft.samples[:GSM77600][:platform_id]     # => "GPL2092"
soft.samples[:GSM77600][:type]            # => "RNA"
soft.samples[:GSM77600][:title]           # => "jst2b2"
soft.samples[:GSM77600][:table].header    # => ["ID_REF", "VALUE"]
soft.samples[:GSM77600][:table].header_description # => {"ID_REF"=>"", "VALUE"=>"normalized signal intensities"}
soft.samples[:GSM77600][:table].rows.size # => 217
soft.samples[:GSM77600][:table].rows[5]   # => ["A039P68U", "8.19"]
soft.samples[:GSM77600][:table].rows[5][0]        # => "A039P68U"
soft.samples[:GSM77600][:table].rows[5][:id_ref]  # => "A039P68U"
soft.samples[:GSM77600][:table].rows[5]['ID_REF'] # => "A039P68U"

lines = IO.readlines('GDS100.soft') 
soft =

soft.database[:name]                      # => "Gene Expression Omnibus (GEO)"
soft.database[:ref]                       # => "Nucleic Acids Res. 2005 Jan 1;33 Database Issue:D562-6"
soft.database[:institute]                 # => "NCBI NLM NIH"

soft.subsets.size                         # => 8
soft.subsets.keys                         # => ["GDS100_1", "GDS100_2", "GDS100_3", "GDS100_4", "GDS100_5", "GDS100_6", "GDS100_7", "GDS100_8"]
soft.subsets[:GDS100_7]                   # => {:dataset_id=>"GDS100", :type=>"time", :sample_id=>"GSM548,GSM543", :description=>"60 minute"}
soft.subsets['GDS100_7'][:sample_id]      # => "GSM548,GSM543"
soft.subsets[:GDS100_7][:sample_id]       # => "GSM548,GSM543"
soft.subsets[:GDS100_7][:dataset_id]      # => "GDS100"

soft.dataset[:order]                      # => "none"
soft.dataset[:sample_organism]            # => "Escherichia coli"
soft.dataset[:table].header               # => ["ID_REF", "IDENTIFIER", "GSM549", "GSM542", "GSM543", "GSM547", "GSM544", "GSM545", "GSM546", "GSM548"]
soft.dataset[:table].rows.size            # => 5764
soft.dataset[:table].rows[5]              # => ["6", "EMPTY", "0.097", "0.217", "0.242", "0.067", "0.104", "0.162", "0.104", "0.154"]
soft.dataset[:table].rows[5][4]           # => "0.242"
soft.dataset[:table].rows[5][:gsm549]     # => "0.097"
soft.dataset[:table].rows[5][:GSM549]     # => "0.097"
soft.dataset[:table].rows[5]['GSM549']    # => "0.097"

Defined Under Namespace

Classes: Database, Dataset, Entity, Platform, Sample, Samples, Series, Subset, Subsets, Table

Constant Summary collapse


data table row defined by absence of line type character


Instance Attribute Summary collapse

Instance Method Summary collapse

Constructor Details

#initialize(lines = nil) ⇒ SOFT



  • lines: (required) contents of SOFT formatted file



# File 'lib/bio/db/soft.rb', line 147

def initialize(lines=nil)
  @database =
  @series =
  @platform =
  @samples =
  @dataset =
  @subsets =

Instance Attribute Details


Returns the value of attribute database

# File 'lib/bio/db/soft.rb', line 130

def database


Returns the value of attribute dataset

# File 'lib/bio/db/soft.rb', line 132

def dataset


Returns the value of attribute platform

# File 'lib/bio/db/soft.rb', line 131

def platform


Returns the value of attribute samples

# File 'lib/bio/db/soft.rb', line 131

def samples


Returns the value of attribute series

# File 'lib/bio/db/soft.rb', line 131

def series


Returns the value of attribute subsets

# File 'lib/bio/db/soft.rb', line 132

def subsets